PlantPromoterDB promoter information of AT3G51810

Summary of Gene (AT3G51810)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G51810 TAIR NCBI
Gene model	AT3G51810
Description	Encodes a ABA-inducible protein that accumulates during seed maturation, in parallel with its corresponding mRNA but with a 3 d delay. During germination, AtEm1 protein undergoes two successive cleavages before being degraded. Both proteins are more stable than the corresponding mRNA. The gene can be activated by the basic leucine zipper transcription factor ABI5. Expressed predominantly in provascular tissues with the strongest expression in the root tip.

#

Overview

Focused view (chromosome 3: 19213818-19215017)

`Genome position from initiation codon` `AT3G51810.1 TSS from cDNA TSS information AT3G51810 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G51810

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak G clone + 19214748 -70

TSS clone peak T clone + 19214749 -69

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`G`	clone	+	19214748	-70
TSS clone peak	`T`	clone	+	19214749	-69

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA - 19213835 19213867 AT3G51800.1, AT3G51800.2

AtREG419 TGACGTGG                          PPDB Motif ACGT PLACE Motif ACGT, ACGTG, TGACGTGG, CCACGTCA

AtREG518     GTGGGCTT                      PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG426      TGGGCTTA                     PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG462       GGGCTTAT                    PPDB Motif GCCCA PLACE Motif

AtREG620            TATATGGG               PPDB Motif GCCCA PLACE Motif

AtREG432             ATATGGGC              PPDB Motif GCCCA PLACE Motif

AtREG364              TATGGGCC             PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG391               ATGGGCCC            PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG501                     CCGGTTAA      PPDB Motif AACCG(G/A) PLACE Motif CNGTTR

AtREG605                      CGGTTAAG     PPDB Motif AACCG(G/A) PLACE Motif CNGTTR

AtREG570                          TAAGGGTA PPDB Motif ACCCT PLACE Motif