version
PlantPromoterDB promoter information of AT3G52040.1

Summary of Gene (AT3G52040.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G52040  TAIR      NCBI 
Gene model AT3G52040.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 19305802-19304603)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G52040.1                      5'->3' (-)
Promoter sequence










 
AT3G52050.1         
AT3G52050.2         
AT3G52050.3         
AT3G52050.4         
AT3G52050.5         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G52040.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-19304856-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATTATATA-1930489319304900-91-98
Y PatchTTCTTCTTCTTCTTCT-1930486219304877-60-75
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATTAT-1930489619304905-94-103
 AtREG372AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357 GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546  CCCATTAT PPDB Motif  PLACE Motif 
REGTAAAGGCCTTAA-1930490719304918-105-116
 AtREG467TAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG416    GGCCTTAA PPDB Motif  PLACE Motif 
REGTCAGCCCATATA-1930492119304932-119-130
 AtREG609TCAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432   GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620    CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCCAATAA-1930493719304951-135-149
 AtREG418AATTGGGC        PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  TTGGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355      GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417       CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+19304993AT3G52050.2, AT3G52050.1, AT3G52050.3, AT3G52050.4, AT3G52050.5

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCGTCGTTTC+1930481019304819AT3G52050.1, AT3G52050.2, AT3G52050.3, AT3G52050.4, AT3G52050.5
 AtREG648TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576  GTCGTTTC PPDB Motif  PLACE Motif 
REGATAATGGGCT+1930489619304905AT3G52050.1, AT3G52050.2, AT3G52050.3, AT3G52050.4, AT3G52050.5
 AtREG546ATAATGGG   PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAAGGCCTTTA+1930490719304918AT3G52050.1, AT3G52050.2, AT3G52050.3, AT3G52050.4, AT3G52050.5
 AtREG416TTAAGGCC     PPDB Motif  PLACE Motif 
 AtREG467    GGCCTTTA PPDB Motif  PLACE Motif 
REGTATATGGGCTGA+1930492119304932AT3G52050.1, AT3G52050.2, AT3G52050.3, AT3G52050.4, AT3G52050.5
 AtREG620TATATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477  TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609    TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTATTGGGCCCAATT+1930493719304951AT3G52050.1, AT3G52050.2, AT3G52050.3, AT3G52050.4, AT3G52050.5
 AtREG417TTATTGGG        PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC       PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422    TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   TTGGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418       GCCCAATT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.