version
PlantPromoterDB promoter information of AT3G52730.1

Summary of Gene (AT3G52730.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G52730  TAIR      NCBI 
Gene model AT3G52730.1  
Description ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 19545167-19543968)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G52730.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G52730.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13-19544274-107

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-19544263-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTCTTCTTC-1954424919544262-82-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGCCCAAAT-1954432619544337-159-170
 AtREG587TGAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGCTA-1954435219544362-185-195
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCCGTTAAA-1954436419544371-197-204
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGGGGCCGTA-1954437819544385-211-218
 AtREG499GGGCCGTA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAATGGGCTTA-1954439319544403-226-236
 AtREG386AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTTTGGGCCTGA-1954446619544477-299-310
 AtREG529TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374    GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAATACCC-1954450619544513-339-346
 AtREG602AAATACCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.