PlantPromoterDB promoter information of AT3G52840

Summary of Gene (AT3G52840)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G52840 TAIR NCBI
Gene model	AT3G52840
Description	beta-galactosidase 2 (BGAL2); FUNCTIONS IN: cation binding, beta-galactosidase activity, catalytic activity; INVOLVED IN: lactose catabolic process, using glucoside 3-dehydrogenase, carbohydrate metabolic process, lactose catabolic process via UDP-galactose, lactose catabolic process; LOCATED IN: apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: BGAL12 (beta-galactosidase 12); beta-galactosidase/ catalytic/ cation binding (TAIR:AT4G26140.1); Has 1237 Blast hits to 1164 proteins in 255 species: Archae - 11; Bacteria - 346; Metazoa - 335; Fungi - 120; Plants - 370; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 19580244-19581443)

`Genome position from initiation codon` `AT3G52840.1 TSS from cDNA TSS information AT3G52840 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G52840

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 2 + 19581154 -90

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	2	+	19581154	-90

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 19581113 -131

TSS clone T clone + 19581152 -92

TSS clone A clone + 19581154 -90

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	19581113	-131
TSS clone	`T`	clone	+	19581152	-92
TSS clone	`A`	clone	+	19581154	-90

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGGTCCCATTAT + 19581030 19581041 -214 -203

AtREG596 GGGTCCCA PPDB Motif GGGACCC PLACE Motif

AtREG546 CCCATTAT PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGGTCCCATTAT`		+	19581030	19581041	-214	-203
	AtREG596	`GGGTCCCA`		PPDB Motif	`GGGACCC`	PLACE Motif
	AtREG546	`CCCATTAT`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None