version
PlantPromoterDB promoter information of AT3G52960

Summary of Gene (AT3G52960)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G52960  TAIR      NCBI 
Gene model AT3G52960  
Description peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 19638699-19639898)

Genome position     
from initiation codon
AT3G52960.1         
TSS from cDNA
TSS information
AT3G52960                        5'->3' (+)
Promoter sequence














 
AT3G52957.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G52960

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA34+19639677-22

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19639668-31
TSS cloneAclone+19639673-26
TSS cloneCclone+19639674-25
TSS cloneAclone+19639677-22
TSS cloneAclone+19639684-15
TSS cloneCclone+19639685-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCT+1963963819639646-61-53
Y PatchCTTCTCTCTCC+1963970619639716717
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAGGCCCATTAAGGCCCAATAACGGCGT+1963940019639428-299-271
 AtREG435GTAGGCCC                      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA                     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT                    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT                   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA                  PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA                 PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604      CCATTAAG                PPDB Motif  PLACE MotifTTAATGG 
 AtREG416         TTAAGGCC             PPDB Motif  PLACE Motif 
 AtREG351          TAAGGCCC            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353           AAGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356            AGGCCCAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352             GGCCCAAT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355              GCCCAATA        PPDB MotifGCCCA  PLACE Motif 
 AtREG417               CCCAATAA       PPDB MotifGCCCA  PLACE Motif 
 AtREG497                     AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGTTTAGGCCCACTA+1963957519639587-124-112
 AtREG430TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482   AGGCCCAC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532     GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGGTAGGCCCAATAA+1963961019639622-89-77
 AtREG435GTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.