version
PlantPromoterDB promoter information of AT3G53580.1

Summary of Gene (AT3G53580.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G53580  TAIR      NCBI 
Gene model AT3G53580.1  
Description diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 19863784-19864983)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G53580.1                      5'->3' (+)
Promoter sequence








 
AT3G53570.1         
AT3G53570.2         
AT3G53570.3         
AT3G53570.4         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G53580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+19864763-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19864770-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTAATGGGCTTTTT+1986458719864601-197-183
 AtREG604CTTAATGG        PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409      GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589       GGCTTTTT PPDB Motif  PLACE Motif 
REGGGCCTTTA+1986460819864615-176-169
 AtREG467GGCCTTTA PPDB Motif  PLACE Motif 
REGGAAACGACA+1986463619864644-148-140
 AtREG576GAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 
REGAAAACGACGTGG+1986466819864679-116-105
 AtREG520AAAACGAC     PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG    PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG465    CGACGTGG PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-19864588AT3G53570.3, AT3G53570.1, AT3G53570.2, AT3G53570.4
TSS clone peakTclone-19864521AT3G53570.3, AT3G53570.1, AT3G53570.2, AT3G53570.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.