version
PlantPromoterDB promoter information of AT3G54190.1

Summary of Gene (AT3G54190.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G54190  TAIR      NCBI 
Gene model AT3G54190.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 20064880-20063681)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G54190.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G54190.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-20064000-120

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-20064154-274
TSS cloneGclone-20064151-271
TSS cloneTclone-20064149-269
TSS cloneAclone-20064085-205
TSS cloneAclone-20064084-204
TSS cloneGclone-20064079-199
TSS cloneAclone-20064028-148

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTT-2006397120063979-91-99
Y PatchCGTCTTCCTCCT-2006400120064012-121-132
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTTCGG-2006414120064148-261-268
 AtREG655TGGTTCGG PPDB Motif  PLACE Motif 
REGACCCCTTAAACGCTGCGTTTTA-2006419920064220-319-340
 AtREG636ACCCCTTA               PPDB MotifACCCCT  PLACE Motif 
 AtREG626       AAACGCTG        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369         ACGCTGCG      PPDB Motif  PLACE Motif 
 AtREG564              GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAGCCCATAA-2006423720064245-357-365
 AtREG477AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394 GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTTATTGGGCTGGGCCAT-2006425320064269-373-389
 AtREG417TTATTGGG          PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC         PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG454      GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG458        CTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437         TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.