version
PlantPromoterDB promoter information of AT3G54910.3

Summary of Gene (AT3G54910.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G54910  TAIR      NCBI 
Gene model AT3G54910.3  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10400.2); Has 661 Blast hits to 647 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 657; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 20345277-20344078)

Genome position     
from initiation codon
AT3G54910.1         
AT3G54910.2         
TSS from cDNA
TSS information
AT3G54910.3                      5'->3' (-)
Promoter sequence

 
AT3G54920.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G54910.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-20344799-522

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA10+20345063AT3G54920.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+20345035AT3G54920.1
TSS cloneTclone+20345082AT3G54920.1
TSS cloneGclone+20345097AT3G54920.1
TSS cloneAclone+20345099AT3G54920.1
TSS cloneAclone+20345100AT3G54920.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+2034501520345022AT3G54920.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGATGGGCCTGGTTATGGGCCTAAC+2034485620344879AT3G54920.1
 AtREG403GATGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354 ATGGGCCT    ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370  TGGGCCTG               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG619   GGGCCTGG              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG394           TTATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG364            TATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358              TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360               GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG535                GGCCTAAC PPDB Motif  PLACE Motif 
REGGCCCATTTA+2034489320344901AT3G54920.1
 AtREG386GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443 CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGAGAGGCCCAATAT+2034495420344966AT3G54920.1
 AtREG411AGAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509     CCCAATAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.