PlantPromoterDB promoter information of AT3G54920.1
Summary of Gene (AT3G54920.1)
|
Overview
|
Focused view (chromosome 3: 20344311-20345510)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G54920.1 5'->3' (+) Promoter sequence AT3G54910.1
AT3G54910.2 AT3G54910.3 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G54920.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 10 | + | 20345063 | -248 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | + | 20345035 | -276 |
| TSS clone | T | clone | + | 20345082 | -229 |
| TSS clone | G | clone | + | 20345097 | -214 |
| TSS clone | A | clone | + | 20345099 | -212 |
| TSS clone | A | clone | + | 20345100 | -211 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTCCTCC | + | 20345015 | 20345022 | -296 | -289 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GATGGGCCTGGTTATGGGCCTAAC | + | 20344856 | 20344879 | -455 | -432 | |||
| AtREG403 | GATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG370 | TGGGCCTG | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG619 | GGGCCTGG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG394 | TTATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG364 | TATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG358 | TGGGCCTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG360 | GGGCCTAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG535 | GGCCTAAC | PPDB Motif | PLACE Motif | ||||||
| REG | GCCCATTTA | + | 20344893 | 20344901 | -418 | -410 | |||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | AGAGGCCCAATAT | + | 20344954 | 20344966 | -357 | -345 | |||
| AtREG411 | AGAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG447 | GAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG509 | CCCAATAT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone peak | T | clone | - | 20344799 | AT3G54910.1, AT3G54910.2, AT3G54910.3 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||