PlantPromoterDB promoter information of AT3G55440.1
Summary of Gene (AT3G55440.1)
|
Overview
|
Focused view (chromosome 3: 20552794-20553993)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G55440.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G55440.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 72 | + | 20553706 | -88 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | + | 20553696 | -98 |
| TSS clone | A | clone | + | 20553697 | -97 |
| TSS clone | G | clone | + | 20553699 | -95 |
| TSS clone | G | clone | + | 20553700 | -94 |
| TSS clone | C | clone | + | 20553701 | -93 |
| TSS clone | A | clone | + | 20553703 | -91 |
| TSS clone | C | clone | + | 20553704 | -90 |
| TSS clone | T | clone | + | 20553705 | -89 |
| TSS clone | A | clone | + | 20553707 | -87 |
| TSS clone | A | clone | + | 20553708 | -86 |
| TSS clone | A | clone | + | 20553713 | -81 |
| TSS clone | T | clone | + | 20553714 | -80 |
| TSS clone | T | clone | + | 20553747 | -47 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TTTATATATATATG | + | 20553663 | 20553676 | -131 | -118 |
| Y Patch | CTCTCTCC | + | 20553732 | 20553739 | -62 | -55 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTAATGGGCCTAAAGCCCATA | + | 20553432 | 20553452 | -362 | -342 | |||
| AtREG396 | TTAATGGG | PPDB Motif | GCCCA | PLACE Motif | TTAATGG | ||||
| AtREG357 | TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG358 | TGGGCCTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG360 | GGGCCTAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG430 | GGCCTAAA | PPDB Motif | PLACE Motif | ||||||
| AtREG365 | TAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG477 | AGCCCATA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | ACGCCGTT | + | 20553470 | 20553477 | -324 | -317 | |||
| AtREG497 | ACGCCGTT | PPDB Motif | AAACG(C/G), CCAACGG | PLACE Motif | |||||
| REG | CACCCCAC | + | 20553494 | 20553501 | -300 | -293 | |||
| AtREG618 | CACCCCAC | PPDB Motif | PLACE Motif | ||||||
| REG | ACCCTAGA | + | 20553611 | 20553618 | -183 | -176 | |||
| AtREG658 | ACCCTAGA | PPDB Motif | ACCCT | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||