PlantPromoterDB promoter information of AT3G55460.1
Summary of Gene (AT3G55460.1)
|
Overview
|
Focused view (chromosome 3: 20560024-20561223)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G55460.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G55460.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | C | 8 | + | 20560869 | -155 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 20560808 | -216 |
| TSS clone | T | clone | + | 20560813 | -211 |
| TSS clone | T | clone | + | 20560825 | -199 |
| TSS clone | G | clone | + | 20560855 | -169 |
| TSS clone | T | clone | + | 20560856 | -168 |
| TSS clone | T | clone | + | 20560858 | -166 |
| TSS clone | T | clone | + | 20560866 | -158 |
| TSS clone | C | clone | + | 20560869 | -155 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAACGCGATAAGGCCAAAAGCCCATTTA | + | 20560726 | 20560754 | -298 | -270 | |||
| AtREG566 | AAAACGCG | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG425 | ATAAGGCC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG409 | AAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | AAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TAAATGGGCCAA | + | 20560756 | 20560767 | -268 | -257 | |||
| AtREG443 | TAAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG386 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG490 | ATGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG484 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||