version
PlantPromoterDB promoter information of AT3G56020

Summary of Gene (AT3G56020)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G56020  TAIR      NCBI 
Gene model AT3G56020  
Description 60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 20792043-20790844)

Genome position     
from initiation codon
AT3G56020.1         
TSS from cDNA
TSS information
AT3G56020                        5'->3' (-)
Promoter sequence














 
AT3G56030.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G56020

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-20791072-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-20791074-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATATACC-2079110320791114-60-71
Y PatchTCTCTCTC-2079107620791083-33-40
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTAGGGT-2079112120791128-78-85
 AtREG658TCTAGGGT PPDB MotifACCCT  PLACE Motif 
REGAGATGGGCCTTAAAGGCCCAATAT-2079116420791187-121-144
 AtREG572AGATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG403 GATGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416     GGCCTTAA            PPDB Motif  PLACE Motif 
 AtREG639         TTAAAGGC        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467          TAAAGGCC       PPDB Motif  PLACE Motif 
 AtREG359           AAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353   TGGGCCTT AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356             AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352              GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355               GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509                CCCAATAT PPDB Motif  PLACE Motif 
REGTTATTGGGCT-2079120720791216-164-173
 AtREG417TTATTGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+20791258AT3G56030.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCCTAGA+2079112120791128AT3G56030.1
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGATATTGGGCCTTTAAGGCCCATCT+2079116420791187AT3G56030.1
 AtREG509ATATTGGG                 PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359     GGGCCTTT            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG467      GGCCTTTA           PPDB Motif  PLACE Motif 
 AtREG639       GCCTTTAA          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG416           TTAAGGCC      PPDB Motif  PLACE Motif 
 AtREG351            TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353    TGGGCCTT AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354              AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403               GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG572                GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAATAA+2079120720791216AT3G56030.1
 AtREG402AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355 GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417  CCCAATAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.