PlantPromoterDB promoter information of AT3G56630
Summary of Gene (AT3G56630)
|
Overview
|
Focused view (chromosome 3: 20964403-20965602)
|
Genome position
from initiation codon AT3G56590.2 TSS from cDNA TSS information AT3G56630 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G56630
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | + | 20978937 | -16 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | G | 10 | + | 20964857 | AT3G56590.1, AT3G56590.2 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | T | clone | + | 20964854 | AT3G56590.1, AT3G56590.2 |
| TSS clone | A | clone | + | 20964909 | AT3G56590.1, AT3G56590.2 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCCTTTCTCTTCCTTCGTCTCTC | + | 20964875 | 20964898 | AT3G56590.1, AT3G56590.2 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | CGTAATTA | + | 20964568 | 20964575 | AT3G56590.1, AT3G56590.2 | ||||
| AtREG646 | CGTAATTA | ABA | PPDB Motif | PLACE Motif | |||||
| REG | ATACCCTT | + | 20964803 | 20964810 | AT3G56590.1, AT3G56590.2 | ||||
| AtREG623 | ATACCCTT | PPDB Motif | ACCCT | PLACE Motif | |||||