PlantPromoterDB promoter information of AT3G56880

Summary of Gene (AT3G56880)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G56880 TAIR NCBI
Gene model	AT3G56880
Description	VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: ATCAMBP25 (ARABIDOPSIS THALIANA CALMODULIN (CAM)-BINDING PROTEIN OF 25 KDA); calmodulin binding (TAIR:AT2G41010.1); Has 78 Blast hits to 78 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 21059044-21060243)

`Genome position from initiation codon` `AT3G56880.1 TSS from cDNA TSS information AT3G56880 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G56880

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 42 + 21059916 -128

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	42	+	21059916	-128

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 21059916 -128

TSS clone A clone + 21059917 -127

TSS clone T clone + 21059922 -122

TSS clone A clone + 21059928 -116

TSS clone T clone + 21059929 -115

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	21059916	-128
TSS clone	`A`	clone	+	21059917	-127
TSS clone	`T`	clone	+	21059922	-122
TSS clone	`A`	clone	+	21059928	-116
TSS clone	`T`	clone	+	21059929	-115

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTCCTC + 21059892 21059900 -152 -144

Y Patch CTCTCTCTCTCTCTCT + 21059946 21059961 -98 -83

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTCCTC`	+	21059892	21059900	-152	-144
Y Patch	`CTCTCTCTCTCTCTCT`	+	21059946	21059961	-98	-83
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ACGCGTGT + 21059810 21059817 -234 -227

AtREG536 ACGCGTGT ABA, Drought PPDB Motif PLACE Motif ACACNNG

REG ACGCGGTT + 21059841 21059848 -203 -196

AtREG441 ACGCGGTT Drought PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ACGCGTGT`		+	21059810	21059817	-234	-227
	AtREG536	`ACGCGTGT`	ABA, Drought	PPDB Motif		PLACE Motif	`ACACNNG`
REG	`ACGCGGTT`		+	21059841	21059848	-203	-196
	AtREG441	`ACGCGGTT`	Drought	PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None