version
PlantPromoterDB promoter information of AT3G57900.1

Summary of Gene (AT3G57900.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G57900  TAIR      NCBI 
Gene model AT3G57900.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 21443574-21442375)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G57900.1                      5'->3' (-)
Promoter sequence













 
AT3G57910.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G57900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAATGGGCTTTAATTAGGCCCAATAA-2144268121442707-107-133
 AtREG396TTAATGGG                    PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT                  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365     GGGCTTTA               PPDB MotifGCCCA  PLACE Motif 
 AtREG545      GGCTTTAA              PPDB Motif  PLACE Motif 
 AtREG506             ATTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360              TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358               TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                 GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                  GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417                   CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCA-2144279721442804-223-230
 AtREG525CAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+21442770AT3G57910.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTCTC+2144273621442745AT3G57910.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTATTGGGCCTAATTAAAGCCCATTAA+2144268121442707AT3G57910.1
 AtREG417TTATTGGG                    PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC                   PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506      GGCCTAAT              PPDB Motif  PLACE Motif 
 AtREG545             TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365              TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376               AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378                AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372                 AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357                  GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396                   CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.