version
PlantPromoterDB promoter information of AT3G58130.1

Summary of Gene (AT3G58130.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G58130  TAIR      NCBI 
Gene model AT3G58130.1  
Description N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 21526946-21528145)

Genome position     
from initiation codon
AT3G58130.2         
TSS from cDNA
TSS information
AT3G58130.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G58130.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+21527621-325

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+21527607-339

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTCCTC+2152758721527597-359-349
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATTGGGCTCA+2152745621527466-490-480
 AtREG355TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485   TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTTGGGCCGTAGTTGGGCCTAAA+2152753421527556-412-390
 AtREG373TTTGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414 TTGGGCCG               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368  TGGGCCGT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG499   GGGCCGTA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG607          AGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG449           GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356            TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358             TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360              GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430               GGCCTAAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.