PlantPromoterDB promoter information of AT3G59420.1

Summary of Gene (AT3G59420.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G59420 TAIR NCBI
Gene model	AT3G59420.1
Description	Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes.

#

Overview

Focused view (chromosome 3: 21963558-21962359)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G59420.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G59420.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None