PlantPromoterDB promoter information of AT3G60820.2
Summary of Gene (AT3G60820.2)
|
Overview
|
Focused view (chromosome 3: 22474809-22473610)
|
Genome position
from initiation codon TSS from cDNA TSS information AT3G60820.2 5'->3' (-) Promoter sequence AT3G60830.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G60820.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 33 | - | 22473908 | -99 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 22473919 | -110 |
| TSS clone | G | clone | - | 22473908 | -99 |
| TSS clone | T | clone | - | 22473892 | -83 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTCCACGT | - | 22473979 | 22473986 | -170 | -177 | |||
| AtREG627 | TTCCACGT | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | ||||
| REG | CAAAGCCCAAATAAGGCCCATTATAAAGCC | - | 22474003 | 22474032 | -194 | -223 | |||
| AtREG559 | CAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG376 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG421 | GCCCAAAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG425 | ATAAGGCC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG361 | GGCCCATT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG357 | GCCCATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG546 | CCCATTAT | PPDB Motif | PLACE Motif | ||||||
| AtREG601 | ATAAAGCC | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone peak | T | clone | + | 22474078 | AT3G60830.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||