PlantPromoterDB promoter information of AT3G62180.1

Summary of Gene (AT3G62180.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G62180 TAIR NCBI
Gene model	AT3G62180.1
Description	invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT2G47050.1); Has 50 Blast hits to 49 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 23021479-23020280)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G62180.1 5'->3' (-) Promoter sequence AT3G62190.1 AT3G62190.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G62180.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 2 - 23020529 -50

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	2	-	23020529	-50

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTTTCTCC - 23020500 23020507 -21 -28

Y Patch CCTCTCTTCTTCCTC - 23020531 23020545 -52 -66

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTTTCTCC`	-	23020500	23020507	-21	-28
Y Patch	`CCTCTCTTCTTCCTC`	-	23020531	23020545	-52	-66
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 + 23021039 AT3G62190.1, AT3G62190.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	+	23021039	AT3G62190.1, AT3G62190.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone + 23021040 AT3G62190.1, AT3G62190.2

TSS clone A clone + 23021092 AT3G62190.1, AT3G62190.2

TSS clone G clone + 23021121 AT3G62190.1, AT3G62190.2

TSS clone T clone + 23021122 AT3G62190.1, AT3G62190.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	+	23021040	AT3G62190.1, AT3G62190.2
TSS clone	`A`	clone	+	23021092	AT3G62190.1, AT3G62190.2
TSS clone	`G`	clone	+	23021121	AT3G62190.1, AT3G62190.2
TSS clone	`T`	clone	+	23021122	AT3G62190.1, AT3G62190.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box ACTATATATT + 23021004 23021013 AT3G62190.1, AT3G62190.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`ACTATATATT`	+	23021004	23021013	AT3G62190.1, AT3G62190.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None