version
PlantPromoterDB promoter information of AT3G62870

Summary of Gene (AT3G62870)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G62870  TAIR      NCBI 
Gene model AT3G62870  
Description 60S ribosomal protein L7A (RPL7aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aA) (TAIR:AT2G47610.1); Has 1582 Blast hits to 1582 proteins in 296 species: Archae - 222; Bacteria - 0; Metazoa - 625; Fungi - 248; Plants - 154; Viruses - 0; Other Eukaryotes - 333 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 23245273-23244074)

Genome position     
from initiation codon
AT3G62870.1         
AT3G62880.1         
AT3G62880.2         
TSS from cDNA
TSS information
AT3G62870                        5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G62870

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-23244326-53

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-23244347-74
TSS cloneGclone-23244346-73
TSS cloneGclone-23244324-51
TSS cloneTclone-23244323-50
TSS cloneGclone-23244321-48
TSS cloneCclone-23244320-47
TSS cloneTclone-23244319-46
TSS cloneGclone-23244315-42
TSS cloneCclone-23244314-41
TSS cloneAclone-23244309-36
TSS cloneGclone-23244308-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTTTATAAATA-2324434723244358-74-85
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGC-2324436623244373-93-100
 AtREG421ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGGGCTTC-2324439723244404-124-131
 AtREG476TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTACGTGTCC-2324442523244433-152-160
 AtREG557TACGTGTC ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG472 ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.