version
PlantPromoterDB promoter information of AT3G63410

Summary of Gene (AT3G63410)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G63410  TAIR      NCBI 
Gene model AT3G63410  
Description Encodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis.  
#
#

Overview

Focused view (chromosome 3: 23418002-23416803)

Genome position     
from initiation codon
AT3G63410.1         
TSS from cDNA
TSS information
AT3G63410                        5'->3' (-)
Promoter sequence









 
AT3G63420.1         
AT3G63420.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G63410

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-23417045-43

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-23417119-117
TSS cloneGclone-23417118-116
TSS cloneTclone-23417117-115
TSS cloneCclone-23417095-93
TSS cloneTclone-23417081-79
TSS cloneTclone-23417077-75
TSS cloneGclone-23417066-64
TSS cloneGclone-23417065-63
TSS cloneGclone-23417054-52
TSS cloneAclone-23417044-42
TSS cloneAclone-23417022-20
TSS cloneGclone-23417018-16
TSS cloneGclone-23417017-15
TSS cloneGclone-23417014-12
TSS cloneTclone-23417005-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTTCCCTCTTCTC-2341702423417042-22-40
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGCCCATGGGCTCA-2341719323417208-191-206
 AtREG485TGAGCCCATGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG591    CCCATGGG     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507   GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGATTTGGGCCAAT-2341721823417229-216-227
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446    GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCAAAACGCCCAATA-2341723523417248-233-246
 AtREG585CAAAACGC       PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG650 AAAACGCC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG355      GCCCAATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+23417313AT3G63420.1, AT3G63420.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.