version
PlantPromoterDB promoter information of AT4G00100.1

Summary of Gene (AT4G00100.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G00100  TAIR      NCBI 
Gene model AT4G00100.1  
Description Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development  
#
#

Overview

Focused view (chromosome 4: 36172-37371)

Genome position     
from initiation codon
AT4G00090.1         
TSS from cDNA
TSS information
AT4G00100.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G00100.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA54+37106-66

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+37084-88
TSS cloneAclone+37096-76
TSS cloneGclone+37097-75
TSS cloneAclone+37100-72
TSS cloneGclone+37101-71
TSS cloneAclone+37106-66
TSS cloneGclone+37107-65
TSS cloneTclone+37110-62
TSS cloneGclone+37119-53
TSS cloneTclone+37120-52
TSS cloneAclone+37125-47
TSS cloneGclone+37126-46
TSS cloneCclone+37127-45
TSS cloneGclone+37135-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGGCTTTTT+3700237012-170-160
 AtREG378ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376 TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409  GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589   GGCTTTTT PPDB Motif  PLACE Motif 
REGACTGGGCCA+3702737035-145-137
 AtREG384ACTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 CTGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAAAGGCCCAC+3704437053-128-119
 AtREG359AAAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482  AGGCCCAC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.