version
PlantPromoterDB promoter information of AT4G00990.1

Summary of Gene (AT4G00990.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G00990  TAIR      NCBI 
Gene model AT4G00990.1  
Description transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 426035-427234)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G00990.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G00990.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTAACCGGT+426727426736-308-299
 AtREG645TTTAACCG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503  TAACCGGT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTAAAGCCCATA+426854426865-181-170
 AtREG545TTAAAGCC     PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGCCACGTCAC+426883426892-152-143
 AtREG388GCCACGTC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419 CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG466  CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.