version
PlantPromoterDB promoter information of AT4G01150

Summary of Gene (AT4G01150)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G01150  TAIR      NCBI 
Gene model AT4G01150  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 492692-493891)

Genome position     
from initiation codon
AT4G01150.1         
AT4G01150.2         
TSS from cDNA
TSS information
AT4G01150                        5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G01150

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA205+493638-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+493548-144
TSS cloneCclone+493592-100
TSS cloneTclone+493637-55
TSS cloneAclone+493638-54
TSS cloneGclone+493639-53
TSS cloneGclone+493641-51
TSS cloneAclone+493646-46
TSS cloneGclone+493650-42
TSS cloneAclone+493667-25
TSS cloneGclone+493675-17
TSS cloneGclone+493682-10

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGATGGGCTTTTA+493452493464-240-228
 AtREG572AGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA PPDB Motif  PLACE Motif 
REGCCCATATA+493469493476-223-216
 AtREG620CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCTAAA+493479493491-213-201
 AtREG572AGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG403 GATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430     GGCCTAAA PPDB Motif  PLACE Motif 
REGCCAATAAG+493557493564-135-128
 AtREG611CCAATAAG PPDB Motif  PLACE Motif 
REGTTCCACGTGTT+493577493587-115-105
 AtREG627TTCCACGT    PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382  CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590   CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.