version
PlantPromoterDB promoter information of AT4G01290.1

Summary of Gene (AT4G01290.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G01290  TAIR      NCBI 
Gene model AT4G01290.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1490 Blast hits to 1141 proteins in 165 species: Archae - 0; Bacteria - 129; Metazoa - 747; Fungi - 206; Plants - 73; Viruses - 0; Other Eukaryotes - 335 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 546032-544833)

Genome position     
from initiation codon
AT4G01310.1         
TSS from cDNA
TSS information
AT4G01290.1                      5'->3' (-)
Promoter sequence






 
AT4G01320.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G01290.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-543867-585
TSS clone peakAclone-543857-575
TSS cloneAclone-543841-559

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCTT-543873543881-591-599
Y PatchCTCTTCTT-543900543907-618-625
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCGCGTG-543945543952-663-670
 AtREG381AGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGAGCGCGTGA-543969543977-687-695
 AtREG381AGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG395 GCGCGTGA PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13-545500AT4G01310.1
TSS peakG4+545802AT4G01320.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-545547AT4G01310.1
TSS cloneAclone-545534AT4G01310.1
TSS cloneAclone-545531AT4G01310.1
TSS cloneCclone-545511AT4G01310.1
TSS cloneCclone-545506AT4G01310.1
TSS cloneCclone-545504AT4G01310.1
TSS cloneTclone-545499AT4G01310.1
TSS cloneCclone-545495AT4G01310.1
TSS cloneGclone-545491AT4G01310.1
TSS cloneAclone+545796AT4G01320.1
TSS cloneAclone+545804AT4G01320.1
TSS cloneGclone+545829AT4G01320.1
TSS cloneCclone+545844AT4G01320.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTC-545467545474AT4G01310.1
Y PatchCCTCTCTTT+545808545816AT4G01320.1
Y PatchCTTTCTTC+545830545837AT4G01320.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATATTGGGGCCTTAG-545624545638AT4G01310.1
 AtREG509ATATTGGG        PPDB Motif  PLACE Motif 
 AtREG351      GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG577       GGCCTTAG PPDB Motif  PLACE Motif 
REGTTTAGGCCCATAT-545693545705AT4G01310.1
 AtREG430TTTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364    GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432     GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAAAT-545722545732AT4G01310.1
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCTAAGGCCCCAATAT+545624545638AT4G01320.1
 AtREG577CTAAGGCC        PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG509       CCCAATAT PPDB Motif  PLACE Motif 
REGATATGGGCCTAAA+545693545705AT4G01320.1
 AtREG432ATATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430     GGCCTAAA PPDB Motif  PLACE Motif 
REGATTTGGGCTTC+545722545732AT4G01320.1
 AtREG421ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.