PlantPromoterDB promoter information of AT4G03205.1

Summary of Gene (AT4G03205.1)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G03205 TAIR NCBI
Gene model	AT4G03205.1
Description	hemf2; FUNCTIONS IN: coproporphyrinogen oxidase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Coproporphyrinogen III oxidase (InterPro:IPR001260); BEST Arabidopsis thaliana protein match is: LIN2 (LESION INITIATION 2); coproporphyrinogen oxidase (TAIR:AT1G03475.1); Has 3355 Blast hits to 3354 proteins in 808 species: Archae - 0; Bacteria - 1338; Metazoa - 90; Fungi - 103; Plants - 54; Viruses - 0; Other Eukaryotes - 1770 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 1406764-1407963)

`Genome position from initiation codon` `TSS from cDNA TSS information AT4G03205.1 5'->3' (+) Promoter sequence AT4G03190.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G03205.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 2 + 1412221 -593

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	2	+	1412221	-593

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone + 1411928 -886

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	+	1411928	-886

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 - 1407132 AT4G03190.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	-	1407132	AT4G03190.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 1407139 AT4G03190.1

TSS clone A clone - 1407137 AT4G03190.1

TSS clone G clone - 1407136 AT4G03190.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	1407139	AT4G03190.1
TSS clone	`A`	clone	-	1407137	AT4G03190.1
TSS clone	`G`	clone	-	1407136	AT4G03190.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TTTATATATATC - 1407160 1407171 AT4G03190.1

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TTTATATATATC`	-	1407160	1407171	AT4G03190.1
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCCAATTA + 1407949 1407956 AT4G03200.1

AtREG600 CCCAATTA PPDB Motif GCCCA PLACE Motif