version
PlantPromoterDB promoter information of AT4G03280.2

Summary of Gene (AT4G03280.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G03280  TAIR      NCBI 
Gene model AT4G03280.2  
Description Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.  
#
#

Overview

Focused view (chromosome 4: 1439462-1440661)

Genome position     
from initiation codon
AT4G03280.1         
TSS from cDNA
TSS information
AT4G03280.2                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G03280.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG51+1440219-243

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+1440164-298
TSS cloneCclone+1440168-294
TSS cloneGclone+1440173-289
TSS cloneCclone+1440174-288
TSS cloneTclone+1440176-286
TSS cloneCclone+1440184-278
TSS cloneTclone+1440185-277
TSS cloneCclone+1440187-275
TSS cloneTclone+1440191-271
TSS cloneAclone+1440210-252
TSS cloneCclone+1440213-249
TSS cloneTclone+1440214-248
TSS cloneCclone+1440215-247
TSS cloneTclone+1440220-242
TSS cloneTclone+1440222-240
TSS cloneTclone+1440234-228
TSS cloneCclone+1440235-227
TSS cloneTclone+1440237-225
TSS cloneTclone+1440240-222
TSS cloneCclone+1440247-215
TSS cloneAclone+1440248-214
TSS cloneTclone+1440252-210
TSS cloneGclone+1440277-185
TSS cloneTclone+1440280-182
TSS cloneTclone+1440281-181
TSS cloneTclone+1440282-180
TSS cloneTclone+1440283-179
TSS cloneCclone+1440284-178
TSS cloneGclone+1440285-177
TSS cloneGclone+1440286-176
TSS cloneAclone+1440289-173
TSS cloneAclone+1440290-172
TSS cloneCclone+1440299-163
TSS cloneTclone+1440300-162
TSS cloneCclone+1440306-156

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCTCTCTCC+14401871440199-275-263
Y PatchTCCTCCTCC+14402371440245-225-217
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTA+14400041440014-458-448
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCAGCCCAATAAGGCCCAC+14400271440045-435-417
 AtREG609TCAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA         PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA        PPDB MotifGCCCA  PLACE Motif 
 AtREG611     CCAATAAG       PPDB Motif  PLACE Motif 
 AtREG425        ATAAGGCC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351         TAAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353          AAGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482           AGGCCCAC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATTGGCCCGTT+14400851440095-377-367
 AtREG446ATTGGCCC   CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG401   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
REGTAAGCCCATTAAG+14400971440109-365-353
 AtREG426TAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604     CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGGGCGCGTG+14401701440177-292-285
 AtREG486GGCGCGTG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.