version
PlantPromoterDB promoter information of AT4G04740.1

Summary of Gene (AT4G04740.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G04740  TAIR      NCBI 
Gene model AT4G04740.1  
Description member of Calcium Dependent Protein Kinase  
#
#

Overview

Focused view (chromosome 4: 2409493-2408294)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G04740.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G04740.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-2408613-120

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2408566-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTATA-24086692408679-176-186
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG629   CCGGTATA PPDB Motif  PLACE Motif 
REGAGCCCAAT-24086992408706-206-213
 AtREG402AGCCCAAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTAAGGCCCAATTAAGGCC-24087152408733-222-240
 AtREG577CTAAGGCC            PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418     GCCCAATT       PPDB MotifGCCCA  PLACE Motif 
 AtREG600      CCCAATTA      PPDB MotifGCCCA  PLACE Motif 
 AtREG416           TTAAGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.