version
PlantPromoterDB promoter information of AT4G05000.1

Summary of Gene (AT4G05000.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G05000  TAIR      NCBI 
Gene model AT4G05000.1  
Description VPS28-2; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated, VPS28, N-terminal (InterPro:IPR017898), Vacuolar protein sorting-associated, VPS28, C-terminal (InterPro:IPR017899), Vacuolar protein sorting-associated, VPS28 (InterPro:IPR007143); BEST Arabidopsis thaliana protein match is: VPS28-1 (VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN 28 HOMOLOG 1); transporter (TAIR:AT4G21560.3); Has 278 Blast hits to 277 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 101; Plants - 39; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 2562953-2564152)

Genome position     
from initiation codon
AT4G05000.2         
TSS from cDNA
TSS information
AT4G05000.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G05000.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+2563044-909
TSS clone peakCclone+2563062-891
TSS cloneGclone+2563069-884

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTCTTC+25630282563038-925-915
Y PatchCCTCTTTCTC+25630452563054-908-899
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGTTCG+25629782562986-975-967
 AtREG528ACCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423 CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTCAA+25629912563000-962-953
 AtREG528ACCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640  CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.