version
PlantPromoterDB promoter information of AT4G08280.1

Summary of Gene (AT4G08280.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G08280  TAIR      NCBI 
Gene model AT4G08280.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin 2 (InterPro:IPR008554), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 214 Blast hits to 214 proteins in 65 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 5229345-5230544)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G08280.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G08280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG31+5230326-19

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+5230326-19
TSS cloneGclone+5230327-18
TSS cloneAclone+5230335-10

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGA+52300585230066-287-279
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAGCCCA+52301555230162-190-183
 AtREG485TGAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTATATGGGCCGAA+52302385230250-107-95
 AtREG620TATATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393    TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427     GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAAGGCCCAAAAGCCCAT+52302675230285-78-60
 AtREG467TAAAGGCC            PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529     GCCCAAAA       PPDB MotifGCCCA  PLACE Motif 
 AtREG409         AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376          AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378           AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.