PlantPromoterDB promoter information of AT4G08685
Summary of Gene (AT4G08685)
|
Overview
|
Focused view (chromosome 4: 5549563-5550762)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G08685 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G08685
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 4 | + | 5550479 | -84 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | + | 5550429 | -134 |
| TSS clone | T | clone | + | 5550480 | -83 |
| TSS clone | A | clone | + | 5550551 | -12 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCCTCTCTTT | + | 5550507 | 5550516 | -56 | -47 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ATCCACGTCATCAAATACCCC | + | 5550325 | 5550345 | -238 | -218 | |||
| AtREG547 | ATCCACGT | ABA | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||
| AtREG419 | CCACGTCA | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG, TGACGTGG, CCACGTCA | ||||
| AtREG483 | CACGTCAT | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | ||||
| AtREG578 | ACGTCATC | ABA | PPDB Motif | ACGT | PLACE Motif | ACGT | |||
| AtREG602 | AAATACCC | PPDB Motif | PLACE Motif | ||||||
| AtREG614 | AATACCCC | PPDB Motif | ACCCCT | PLACE Motif | |||||
| REG | TTCACGCGCC | + | 5550410 | 5550419 | -153 | -144 | |||
| AtREG631 | TTCACGCG | Drought | PPDB Motif | PLACE Motif | |||||
| AtREG395 | TCACGCGC | PPDB Motif | ACGCGC | PLACE Motif | |||||
| AtREG486 | CACGCGCC | PPDB Motif | ACGCGC | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||