PlantPromoterDB promoter information of AT4G09010

Summary of Gene (AT4G09010)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G09010 TAIR NCBI
Gene model	AT4G09010
Description	Encodes a microsomal ascorbate peroxidase APX4. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.

#

Overview

Focused view (chromosome 4: 5776338-5775139)

`Genome position from initiation codon` `TSS from cDNA TSS information AT4G09010 5'->3' (-) Promoter sequence AT4G09000.1 AT4G09000.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G09010

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 41 - 5779390 -52

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	41	-	5779390	-52

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone - 5779462 -124

TSS clone T clone - 5779392 -54

TSS clone G clone - 5779389 -51

TSS clone T clone - 5779356 -18

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	-	5779462	-124
TSS clone	`T`	clone	-	5779392	-54
TSS clone	`G`	clone	-	5779389	-51
TSS clone	`T`	clone	-	5779356	-18

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTTTCTCCTTTCTTCTCTCTTCTCT - 5779358 5779384 -20 -46

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTTTCTCCTTTCTTCTCTCTTCTCT`	-	5779358	5779384	-20	-46
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATATTGGG - 5779603 5779610 -265 -272

AtREG509 ATATTGGG PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATATTGGG`		-	5779603	5779610	-265	-272
	AtREG509	`ATATTGGG`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 10 + 5775237 AT4G09000.1, AT4G09000.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	10	+	5775237	AT4G09000.1, AT4G09000.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone + 5775210 AT4G09000.1, AT4G09000.2

TSS clone A clone + 5775266 AT4G09000.1, AT4G09000.2

TSS clone A clone + 5775299 AT4G09000.1, AT4G09000.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	+	5775210	AT4G09000.1, AT4G09000.2
TSS clone	`A`	clone	+	5775266	AT4G09000.1, AT4G09000.2
TSS clone	`A`	clone	+	5775299	AT4G09000.1, AT4G09000.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCCTTTCTTCTC + 5775217 5775229 AT4G09000.1, AT4G09000.2

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCCTTTCTTCTC`	+	5775217	5775229	AT4G09000.1, AT4G09000.2
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None