version
PlantPromoterDB promoter information of AT4G10340

Summary of Gene (AT4G10340)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G10340  TAIR      NCBI 
Gene model AT4G10340  
Description photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus  
#
#

Overview

Focused view (chromosome 4: 6404300-6405499)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G10340                        5'->3' (+)
Promoter sequence

 
AT4G10320.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G10340

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA303+6408148-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+6408109-91
TSS cloneAclone+6408111-89
TSS cloneTclone+6408112-88
TSS cloneTclone+6408140-60
TSS cloneCclone+6408143-57
TSS cloneAclone+6408144-56
TSS cloneCclone+6408145-55
TSS cloneTclone+6408146-54
TSS cloneAclone+6408148-52
TSS cloneGclone+6408149-51
TSS cloneTclone+6408151-49
TSS cloneTclone+6408153-47
TSS cloneCclone+6408156-44
TSS cloneTclone+6408157-43
TSS cloneTclone+6408162-38
TSS cloneAclone+6408175-25
TSS cloneAclone+6408194-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCCTCCTTCT+64081266408140-74-60
Y PatchCTCTTCCT+64081506408157-50-43
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAAGCC+64080086408015-192-185
 AtREG549TAAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-6404568AT4G10320.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACGGCCCATTAA-64046296404641AT4G10320.1
 AtREG499TACGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG368 ACGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  CGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTTAATGGGCTTA-64046436404654AT4G10320.1
 AtREG396TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTTGACCC-64046736404680AT4G10320.1
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGCCAATAAG-64046876404694AT4G10320.1
 AtREG611CCAATAAG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.