version
PlantPromoterDB promoter information of AT4G10340

Summary of Gene (AT4G10340)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G10340  TAIR      NCBI 
Gene model AT4G10340  
Description photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus  
#
#

Overview

Focused view (chromosome 4: 6406050-6407249)

Genome position     
from initiation codon
AT4G10330.1         
TSS from cDNA
TSS information
AT4G10340                        5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G10340

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA303+6408148-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+6408109-91
TSS cloneAclone+6408111-89
TSS cloneTclone+6408112-88
TSS cloneTclone+6408140-60
TSS cloneCclone+6408143-57
TSS cloneAclone+6408144-56
TSS cloneCclone+6408145-55
TSS cloneTclone+6408146-54
TSS cloneAclone+6408148-52
TSS cloneGclone+6408149-51
TSS cloneTclone+6408151-49
TSS cloneTclone+6408153-47
TSS cloneCclone+6408156-44
TSS cloneTclone+6408157-43
TSS cloneTclone+6408162-38
TSS cloneAclone+6408175-25
TSS cloneAclone+6408194-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCCTCCTTCT+64081266408140-74-60
Y PatchCTCTTCCT+64081506408157-50-43
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAAGCC+64080086408015-192-185
 AtREG549TAAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+6406508AT4G10330.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+6406543AT4G10330.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATAA+64064826406489AT4G10330.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTATTGGGCTGAAGTTGGGCCTTG+64064436406466AT4G10330.1
 AtREG624CTATTGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609    TGGGCTGA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG607            AGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG449             GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356              TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353               TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398                GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.