PlantPromoterDB promoter information of AT4G10340
Summary of Gene (AT4G10340)
|
Overview
|
Focused view (chromosome 4: 6406100-6407299)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G10340 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G10340
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 303 | + | 6408148 | -52 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 6408109 | -91 |
| TSS clone | A | clone | + | 6408111 | -89 |
| TSS clone | T | clone | + | 6408112 | -88 |
| TSS clone | T | clone | + | 6408140 | -60 |
| TSS clone | C | clone | + | 6408143 | -57 |
| TSS clone | A | clone | + | 6408144 | -56 |
| TSS clone | C | clone | + | 6408145 | -55 |
| TSS clone | T | clone | + | 6408146 | -54 |
| TSS clone | A | clone | + | 6408148 | -52 |
| TSS clone | G | clone | + | 6408149 | -51 |
| TSS clone | T | clone | + | 6408151 | -49 |
| TSS clone | T | clone | + | 6408153 | -47 |
| TSS clone | C | clone | + | 6408156 | -44 |
| TSS clone | T | clone | + | 6408157 | -43 |
| TSS clone | T | clone | + | 6408162 | -38 |
| TSS clone | A | clone | + | 6408175 | -25 |
| TSS clone | A | clone | + | 6408194 | -6 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTCTTCCTCCTTCT | + | 6408126 | 6408140 | -74 | -60 |
| Y Patch | CTCTTCCT | + | 6408150 | 6408157 | -50 | -43 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TAAAAGCC | + | 6408008 | 6408015 | -192 | -185 | |||
| AtREG549 | TAAAAGCC | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 8 | + | 6406508 | AT4G10330.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | A | clone | + | 6406543 | AT4G10330.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CCTTATAA | + | 6406482 | 6406489 | AT4G10330.1 | |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | CTATTGGGCTGAAGTTGGGCCTTG | + | 6406443 | 6406466 | AT4G10330.1 | ||||
| AtREG624 | CTATTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG355 | TATTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG402 | ATTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG609 | TGGGCTGA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG607 | AGTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG449 | GTTGGGCC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | TTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG353 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG398 | GGGCCTTG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||