version
PlantPromoterDB promoter information of AT4G12800

Summary of Gene (AT4G12800)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G12800  TAIR      NCBI 
Gene model AT4G12800  
Description Encodes subunit L of photosystem I reaction center.  
#
#

Overview

Focused view (chromosome 4: 7518669-7519868)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G12800                        5'->3' (+)
Promoter sequence

 
AT4G12790.1         
AT4G12790.2         
AT4G12790.3         
AT4G12790.4         
AT4G12790.5         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G12800

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA644+7521440-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+7521408-61
TSS cloneCclone+7521410-59
TSS cloneAclone+7521428-41
TSS cloneTclone+7521429-40
TSS cloneAclone+7521433-36
TSS cloneAclone+7521434-35
TSS cloneTclone+7521435-34
TSS cloneAclone+7521440-29
TSS cloneTclone+7521441-28
TSS cloneAclone+7521443-26
TSS cloneAclone+7521451-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATTGGG+75212517521258-218-211
 AtREG509ATATTGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13-7519397AT4G12790.1, AT4G12790.2, AT4G12790.3, AT4G12790.4, AT4G12790.5

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-7519406AT4G12790.1, AT4G12790.2, AT4G12790.3, AT4G12790.4, AT4G12790.5
TSS cloneAclone-7519396AT4G12790.1, AT4G12790.2, AT4G12790.3, AT4G12790.4, AT4G12790.5

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCTTCTTCTT-75193777519392AT4G12790.1, AT4G12790.2, AT4G12790.3, AT4G12790.4, AT4G12790.5
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCACGTGAGACACGT-75195887519604AT4G12790.1, AT4G12790.2, AT4G12790.3, AT4G12790.4, AT4G12790.5
 AtREG547ATCCACGT         ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG        ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG470         AGACACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.