version
PlantPromoterDB promoter information of AT4G13340.1

Summary of Gene (AT4G13340.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G13340  TAIR      NCBI 
Gene model AT4G13340.1  
Description leucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 7757610-7758809)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G13340.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G13340.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+7758455-155

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTTTC+77584077758416-203-194
Y PatchCCTCTTTCTCCTTC+77584307758443-180-167
Y PatchCCTCCTTCTCTTCCTC+77584647758479-146-131
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAA+77581647758171-446-439
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAACCA+77581807758190-430-420
 AtREG568AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655   CCGAACCA PPDB Motif  PLACE Motif 
REGCCAAACCGTAAACCGGAT+77582407758257-370-353
 AtREG550CCAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519       GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412        TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521         AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561          AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTATATGGG+77583027758309-308-301
 AtREG620TATATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.