PlantPromoterDB promoter information of AT4G14110.1
Summary of Gene (AT4G14110.1)
|
Overview
|
Focused view (chromosome 4: 8135867-8134668)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G14110.1 5'->3' (-) Promoter sequence AT4G14120.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G14110.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 8 | - | 8134921 | -54 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TCGGTTTAAGTAAACCGT | - | 8134991 | 8135008 | -124 | -141 | |||
| AtREG514 | TCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG473 | CGGTTTAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG519 | GTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG652 | TAAACCGT | PPDB Motif | PLACE Motif | ||||||
| REG | TAGTGGGCTTGGCCCATTTA | - | 8135036 | 8135055 | -169 | -188 | |||
| AtREG532 | TAGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG510 | AGTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG518 | GTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG525 | TGGGCTTG | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG484 | TTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG490 | TGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG361 | GGCCCATT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGCTTTAT | - | 8135080 | 8135087 | -213 | -220 | |||
| AtREG601 | GGCTTTAT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||