version
PlantPromoterDB promoter information of AT4G14260.1

Summary of Gene (AT4G14260.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14260  TAIR      NCBI 
Gene model AT4G14260.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25920.1); Has 126 Blast hits to 124 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8218571-8217372)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G14260.1                      5'->3' (-)
Promoter sequence

 
AT4G14270.1         
AT4G14270.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG26+8218385AT4G14270.1, AT4G14270.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+8218378AT4G14270.1, AT4G14270.2
TSS cloneAclone+8218379AT4G14270.1, AT4G14270.2
TSS cloneAclone+8218381AT4G14270.1, AT4G14270.2
TSS cloneCclone+8218386AT4G14270.1, AT4G14270.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTT+82183418218349AT4G14270.1, AT4G14270.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTTAATGGGCTTATGGGCTTC+82180918218111AT4G14270.1, AT4G14270.2
 AtREG604CTTAATGG              PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG             PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTTATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426     TGGGCTTA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462      GGGCTTAT        PPDB MotifGCCCA  PLACE Motif 
 AtREG394          TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477           TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476             TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCCCAATTA+82182278218234AT4G14270.1, AT4G14270.2
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGACCGTCAGA+82182498218257AT4G14270.1, AT4G14270.2
 AtREG625ACCGTCAG  PPDB Motif  PLACE Motif 
 AtREG622 CCGTCAGA PPDB Motif  PLACE Motif 
REGGCCCTTAT+82182628218269AT4G14270.1, AT4G14270.2
 AtREG616GCCCTTAT PPDB Motif  PLACE Motif 
REGACCGTCAGA+82182788218286AT4G14270.1, AT4G14270.2
 AtREG625ACCGTCAG  PPDB Motif  PLACE Motif 
 AtREG622 CCGTCAGA PPDB Motif  PLACE Motif 
REGTCACACGTGGC+82183028218312AT4G14270.1, AT4G14270.2
 AtREG588TCACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382  ACACGTGG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367   CACGTGGCABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
REGATAACCGGAT+82183298218338AT4G14270.1, AT4G14270.2
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.