version
PlantPromoterDB promoter information of AT4G14310.1

Summary of Gene (AT4G14310.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14310  TAIR      NCBI 
Gene model AT4G14310.1  
Description INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); Has 1571 Blast hits to 1320 proteins in 206 species: Archae - 6; Bacteria - 142; Metazoa - 581; Fungi - 102; Plants - 66; Viruses - 5; Other Eukaryotes - 669 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8241324-8240125)

Genome position     
from initiation codon
AT4G14310.2         
TSS from cDNA
TSS information
AT4G14310.1                      5'->3' (-)
Promoter sequence

 
AT4G14315.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14310.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+8240957AT4G14315.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTGTATATATAAC+82409198240932AT4G14315.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAAACGCTGCG+82406728240683AT4G14315.1
 AtREG564TAAAACGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626  AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369    ACGCTGCG PPDB Motif  PLACE Motif 
REGAACACGTGGCAG+82407628240773AT4G14315.1
 AtREG590AACACGTG    ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367  CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG468    CGTGGCAGABA PPDB Motif  PLACE MotifGCCAC 
REGATAAACCGAA+82407808240789AT4G14315.1
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGCAGCGTTTTGA+82407918240803AT4G14315.1
 AtREG369CGCAGCGT      PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585    GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653     CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGAAACGACAC+82408858240894AT4G14315.1
 AtREG576GAAACGAC   PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA  PPDB Motif  PLACE Motif 
 AtREG527  AACGACACDREB1Aox PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.