version
PlantPromoterDB promoter information of AT4G14890.1

Summary of Gene (AT4G14890.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G14890  TAIR      NCBI 
Gene model AT4G14890.1  
Description ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 8519887-8521086)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G14890.1                      5'->3' (+)
Promoter sequence






 
AT4G14880.1         
AT4G14880.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G14890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG10+8520866-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+8520832-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC+85208718520878-16-9
Y PatchTCTCTCAT+85208818520888-61
Y PatchCTCTTCCTCTCC+85208948520905718
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGTTT+85205728520579-315-308
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATTACG+85206728520679-215-208
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGTTCGGTTTAA+85207258520734-162-153
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAAGTCGGTTTTCGGTTT+85207488520772-139-115
 AtREG568TTCGGTTT         TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG582       TAAGTCGG           PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG641         AGTCGGTT         PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA34-8520395AT4G14880.1, AT4G14880.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-8520468AT4G14880.1, AT4G14880.2
TSS cloneAclone-8520467AT4G14880.1, AT4G14880.2
TSS cloneCclone-8520437AT4G14880.1, AT4G14880.2
TSS cloneCclone-8520398AT4G14880.1, AT4G14880.2
TSS cloneAclone-8520397AT4G14880.1, AT4G14880.2
TSS cloneTclone-8520396AT4G14880.1, AT4G14880.2
TSS cloneAclone-8520395AT4G14880.1, AT4G14880.2
TSS cloneCclone-8520394AT4G14880.1, AT4G14880.2
TSS cloneAclone-8520354AT4G14880.1, AT4G14880.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATCT-85204208520429AT4G14880.1, AT4G14880.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCGTTTT-85204728520479AT4G14880.1, AT4G14880.2
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTAACCGGAC-85205368520545AT4G14880.1, AT4G14880.2
 AtREG501TTAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA-85205728520579AT4G14880.1, AT4G14880.2
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGTAATTA-85206728520679AT4G14880.1, AT4G14880.2
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.