PlantPromoterDB promoter information of AT4G15200.1

Summary of Gene (AT4G15200.1)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G15200 TAIR NCBI
Gene model	AT4G15200.1
Description	actin binding; FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 and DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: Fh5 (FORMIN HOMOLOGY5); actin binding (TAIR:AT5G54650.2); Has 59336 Blast hits to 26074 proteins in 1259 species: Archae - 81; Bacteria - 10300; Metazoa - 19143; Fungi - 4772; Plants - 12112; Viruses - 2753; Other Eukaryotes - 10175 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 8670359-8669160)

`Genome position from initiation codon` `AT4G15210.1 AT4G15210.2 TSS from cDNA TSS information AT4G15200.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G15200.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 17 - 8669465 AT4G15210.1, AT4G15210.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	17	-	8669465	AT4G15210.1, AT4G15210.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 8669470 AT4G15210.1, AT4G15210.2

TSS clone A clone - 8669465 AT4G15210.1, AT4G15210.2

TSS clone T clone - 8669464 AT4G15210.1, AT4G15210.2

TSS clone G clone - 8669463 AT4G15210.1, AT4G15210.2

TSS clone T clone - 8669462 AT4G15210.1, AT4G15210.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	8669470	AT4G15210.1, AT4G15210.2
TSS clone	`A`	clone	-	8669465	AT4G15210.1, AT4G15210.2
TSS clone	`T`	clone	-	8669464	AT4G15210.1, AT4G15210.2
TSS clone	`G`	clone	-	8669463	AT4G15210.1, AT4G15210.2
TSS clone	`T`	clone	-	8669462	AT4G15210.1, AT4G15210.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box CTTCTATATAAAGA - 8669492 8669505 AT4G15210.1, AT4G15210.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTCTATATAAAGA`	-	8669492	8669505	AT4G15210.1, AT4G15210.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG GTCGTTTT - 8669550 8669557 AT4G15210.1, AT4G15210.2

AtREG520 GTCGTTTT PPDB Motif PLACE Motif

REG AAATGACG - 8669642 8669649 AT4G15210.1, AT4G15210.2

AtREG657 AAATGACG PPDB Motif PLACE Motif