PlantPromoterDB promoter information of AT4G15910
Summary of Gene (AT4G15910)
|
Overview
|
Focused view (chromosome 4: 9027657-9028856)
|
Genome position
from initiation codon AT4G15910.1 TSS from cDNA TSS information AT4G15910 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G15910
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 8 | + | 9028468 | -189 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | + | 9028463 | -194 |
| TSS clone | T | clone | + | 9028464 | -193 |
| TSS clone | C | clone | + | 9028465 | -192 |
| TSS clone | T | clone | + | 9028466 | -191 |
| TSS clone | A | clone | + | 9028469 | -188 |
| TSS clone | A | clone | + | 9028470 | -187 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | GTCTATATAAG | + | 9028428 | 9028438 | -229 | -219 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTGGGTCC | + | 9028384 | 9028391 | -273 | -266 | |||
| AtREG523 | GTGGGTCC | PPDB Motif | GGGACCC | PLACE Motif | |||||
| REG | GTAAGGCCCATGAGCCCAAAT | + | 9028395 | 9028415 | -262 | -242 | |||
| AtREG530 | GTAAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG504 | GGCCCATG | PPDB Motif | GCCCA, CCATGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG485 | TGAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG533 | GAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG421 | GCCCAAAT | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||