version
PlantPromoterDB promoter information of AT4G16440.1

Summary of Gene (AT4G16440.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G16440  TAIR      NCBI 
Gene model AT4G16440.1  
Description Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing.  
#
#

Overview

Focused view (chromosome 4: 9272510-9271311)

Genome position     
from initiation codon
AT4G16442.1         
TSS from cDNA
TSS information
AT4G16440.1                      5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G16440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-9272295-785
TSS peakA4-9271660-150

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-9271668-158

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGACTTT-92717139271720-203-210
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGCTAGGCCC-92717399271746-229-236
 AtREG475CTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTTAGGCCC-92717669271774-256-264
 AtREG430TTTAGGCC  PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGG-92724109272417-900-907
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGTGGGCCTTTT-92725869272595-1076-1085
 AtREG353TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359 GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459  GGCCTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.