version
PlantPromoterDB promoter information of AT4G18100

Summary of Gene (AT4G18100)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G18100  TAIR      NCBI 
Gene model AT4G18100  
Description 60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10037475-10036276)

Genome position     
from initiation codon
AT4G18100.1         
AT4G18110.1         
TSS from cDNA
TSS information
AT4G18100                        5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G18100

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA170-10036517-42

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-10036517-42
TSS cloneCclone-10036516-41
TSS cloneGclone-10036515-40
TSS cloneGclone-10036514-39
TSS cloneAclone-10036513-38
TSS cloneTclone-10036511-36
TSS cloneCclone-10036510-35
TSS cloneCclone-10036508-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCTTATAAAAG-1003654410036555-69-80
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGCCCATTTA-1003658410036595-109-120
 AtREG485TGAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443    CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGCTTATTGGGCCAC-1003660010036612-125-137
 AtREG611CTTATTGG      PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352   ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420    TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445     TGGGCCAC PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
REGAAAAGGCC-1003662410036631-149-156
 AtREG459AAAAGGCC PPDB Motif  PLACE Motif 
REGGGCTTTTT-1003679310036800-318-325
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.