version
PlantPromoterDB promoter information of AT4G18465.1

Summary of Gene (AT4G18465.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G18465  TAIR      NCBI 
Gene model AT4G18465.1  
Description RNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 7224 Blast hits to 6791 proteins in 1024 species: Archae - 6; Bacteria - 1974; Metazoa - 1905; Fungi - 796; Plants - 374; Viruses - 693; Other Eukaryotes - 1476 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10196056-10197255)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G18465.1                      5'->3' (+)
Promoter sequence




 
AT4G18460.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G18465.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+10197016-40

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAACCA+1019686210196872-194-184
 AtREG568AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655   CCGAACCA PPDB Motif  PLACE Motif 
REGTTGAACCG+1019688910196896-167-160
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGACCCGAA+1019692710196934-129-122
 AtREG597GACCCGAA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTTCC-1019678510196795AT4G18460.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGTTCGGTTT-1019686210196872AT4G18460.1
 AtREG655TGGTTCGG    PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTCAA-1019688910196896AT4G18460.1
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGGTC-1019692710196934AT4G18460.1
 AtREG597TTCGGGTC PPDB MotifGGGACCC  PLACE Motif 
REGGGCTTTTT-1019699610197003AT4G18460.1
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGCAAAACGCC-1019705810197066AT4G18460.1
 AtREG585CAAAACGC  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG650 AAAACGCC PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.