PlantPromoterDB promoter information of AT4G19410

Summary of Gene (AT4G19410)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G19410 TAIR NCBI
Gene model	AT4G19410
Description	pectinacetylesterase, putative; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: pectinacetylesterase, putative (TAIR:AT5G45280.2); Has 403 Blast hits to 397 proteins in 75 species: Archae - 2; Bacteria - 28; Metazoa - 113; Fungi - 0; Plants - 158; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 10585766-10584567)

`Genome position from initiation codon` `AT4G19410.1 TSS from cDNA TSS information AT4G19410 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G19410

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 8 - 10585745 -979

TSS peak C 8 - 10585736 -970

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	8	-	10585745	-979
TSS peak	`C`	8	-	10585736	-970

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 10585765 -999

TSS clone A clone - 10585745 -979

TSS clone G clone - 10585742 -976

TSS clone G clone - 10585741 -975

TSS clone T clone - 10585739 -973

TSS clone T clone - 10585734 -968

TSS clone A clone - 10585725 -959

TSS clone C clone - 10585700 -934

TSS clone T clone - 10585699 -933

TSS clone A clone - 10585689 -923

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	10585765	-999
TSS clone	`A`	clone	-	10585745	-979
TSS clone	`G`	clone	-	10585742	-976
TSS clone	`G`	clone	-	10585741	-975
TSS clone	`T`	clone	-	10585739	-973
TSS clone	`T`	clone	-	10585734	-968
TSS clone	`A`	clone	-	10585725	-959
TSS clone	`C`	clone	-	10585700	-934
TSS clone	`T`	clone	-	10585699	-933
TSS clone	`A`	clone	-	10585689	-923

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTCCTCTCT - 10585699 10585707 -933 -941

Y Patch CTCTCTCTTTC - 10585711 10585721 -945 -955

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTCCTCTCT`	-	10585699	10585707	-933	-941
Y Patch	`CTCTCTCTTTC`	-	10585711	10585721	-945	-955
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CGTTGGAT - 10585942 10585949 -1176 -1183

AtREG586 CGTTGGAT PPDB Motif CCAACGG PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CGTTGGAT`		-	10585942	10585949	-1176	-1183
	AtREG586	`CGTTGGAT`		PPDB Motif	`CCAACGG`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None