PlantPromoterDB promoter information of AT4G21960.1
Summary of Gene (AT4G21960.1)
|
Overview
|
Focused view (chromosome 4: 11655662-11654463)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G21960.1 5'->3' (-) Promoter sequence AT4G21980.1
AT4G21980.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G21960.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 218 | - | 11648356 | -44 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 11648462 | -150 |
| TSS clone | T | clone | - | 11648424 | -112 |
| TSS clone | C | clone | - | 11648376 | -64 |
| TSS clone | A | clone | - | 11648360 | -48 |
| TSS clone | C | clone | - | 11648359 | -47 |
| TSS clone | T | clone | - | 11648358 | -46 |
| TSS clone | C | clone | - | 11648357 | -45 |
| TSS clone | A | clone | - | 11648356 | -44 |
| TSS clone | A | clone | - | 11648355 | -43 |
| TSS clone | C | clone | - | 11648352 | -40 |
| TSS clone | A | clone | - | 11648351 | -39 |
| TSS clone | A | clone | - | 11648350 | -38 |
| TSS clone | G | clone | - | 11648349 | -37 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GCCTTTAA | - | 11648462 | 11648469 | -150 | -157 | |||
| AtREG639 | GCCTTTAA | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| REG | TGTCACGT | - | 11648508 | 11648515 | -196 | -203 | |||
| AtREG606 | TGTCACGT | ABA | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 4 | + | 11655580 | AT4G21980.1, AT4G21980.2 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTTTCTCT | + | 11655661 | 11655668 | AT4G21980.1, AT4G21980.2 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | TAAAGGCCCAATTAGCCCAAAACGACAC | + | 11655448 | 11655475 | AT4G21980.1, AT4G21980.2 | ||||
| AtREG467 | TAAAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG359 | AAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG418 | GCCCAATT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG600 | CCCAATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG571 | TTAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG469 | AGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG529 | GCCCAAAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG520 | AAAACGAC | PPDB Motif | PLACE Motif | ||||||
| AtREG569 | AAACGACA | PPDB Motif | PLACE Motif | ||||||
| AtREG527 | AACGACAC | DREB1Aox | PPDB Motif | PLACE Motif | |||||