version
PlantPromoterDB promoter information of AT4G21960.1

Summary of Gene (AT4G21960.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G21960  TAIR      NCBI 
Gene model AT4G21960.1  
Description Encodes AT4g21960 (AT4g21960/T8O5_170).  
#
#

Overview

Focused view (chromosome 4: 11656712-11655513)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G21960.1                      5'->3' (-)
Promoter sequence

 
AT4G21980.1         
AT4G21980.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G21960.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA218-11648356-44

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-11648462-150
TSS cloneTclone-11648424-112
TSS cloneCclone-11648376-64
TSS cloneAclone-11648360-48
TSS cloneCclone-11648359-47
TSS cloneTclone-11648358-46
TSS cloneCclone-11648357-45
TSS cloneAclone-11648356-44
TSS cloneAclone-11648355-43
TSS cloneCclone-11648352-40
TSS cloneAclone-11648351-39
TSS cloneAclone-11648350-38
TSS cloneGclone-11648349-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCTTTAA-1164846211648469-150-157
 AtREG639GCCTTTAA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTGTCACGT-1164850811648515-196-203
 AtREG606TGTCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+11655580AT4G21980.1, AT4G21980.2
TSS peakA4+11655673AT4G21980.1, AT4G21980.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+11655671AT4G21980.1, AT4G21980.2
TSS cloneAclone+11655731AT4G21980.1, AT4G21980.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCT+1165566111655668AT4G21980.1, AT4G21980.2
Y PatchCTTCTCTCTCTC+1165567811655689AT4G21980.1, AT4G21980.2
Y PatchTTCTTCTTCTCC+1165569211655703AT4G21980.1, AT4G21980.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.