version
PlantPromoterDB promoter information of AT4G22840.1

Summary of Gene (AT4G22840.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G22840  TAIR      NCBI 
Gene model AT4G22840.1  
Description bile acid:sodium symporter family protein; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); BEST Arabidopsis thaliana protein match is: bile acid:sodium symporter family protein (TAIR:AT4G12030.2); Has 2570 Blast hits to 2568 proteins in 443 species: Archae - 24; Bacteria - 852; Metazoa - 337; Fungi - 0; Plants - 149; Viruses - 0; Other Eukaryotes - 1208 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 11994676-11993477)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G22840.1                      5'->3' (-)
Promoter sequence





 
AT4G22850.1         
AT4G22850.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G22840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11993770-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCTCTTTCTTC-1199375111993767-75-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGTCGGGTC-1199382111993830-145-154
 AtREG442GGGTCGGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 GGTCGGGT  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390  GTCGGGTC PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
REGTGGGCCAT-1199385411993861-178-185
 AtREG437TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTAAAGCCCA-1199386311993872-187-196
 AtREG545TTAAAGCC   PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC  PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+11994062AT4G22850.1, AT4G22850.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+11994043AT4G22850.1, AT4G22850.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTTTCTTTCCT+1199404411994059AT4G22850.1, AT4G22850.2
Y PatchTTCTTCTT+1199409511994102AT4G22850.1, AT4G22850.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGGACCC+1199377911993786AT4G22850.1, AT4G22850.2
 AtREG596TGGGACCC PPDB MotifGGGACCC  PLACE Motif 
REGAACCCGACCCGACCC+1199381611993830AT4G22850.1, AT4G22850.2
 AtREG580AACCCGAC        PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 ACCCGACCCGACC  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  CCCGACCCGACCC PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375   CCGACCCG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383    CGACCCGA    PPDB Motif  PLACE Motif 
 AtREG390     GACCCGAC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
REGATGGCCCA+1199385411993861AT4G22850.1, AT4G22850.2
 AtREG437ATGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGGGCTTTAA+1199386311993872AT4G22850.1, AT4G22850.2
 AtREG376TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365 GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545  GGCTTTAA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.